ID: 934327514_934327516

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 934327514 934327516
Species Human (GRCh38) Human (GRCh38)
Location 2:92032140-92032162 2:92032164-92032186
Sequence CCAGTATAGGACAAGAGCTGTCT TCAAAAGGAGAGTAGTTAACTGG
Strand - +
Off-target summary {0: 15, 1: 1, 2: 0, 3: 8, 4: 76} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!