ID: 934476879_934476886

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 934476879 934476886
Species Human (GRCh38) Human (GRCh38)
Location 2:94599549-94599571 2:94599568-94599590
Sequence CCATTAACCACCCGTGTATCCAC CCACATATCACCCCTTGGCTGGG
Strand - +
Off-target summary {0: 6, 1: 3, 2: 2, 3: 5, 4: 58} {0: 9, 1: 0, 2: 0, 3: 6, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!