ID: 934616197_934616201

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 934616197 934616201
Species Human (GRCh38) Human (GRCh38)
Location 2:95772764-95772786 2:95772795-95772817
Sequence CCTTCAGGAACCCTCATGGAGGC TCCCCCACTTTCTGCCAGGCAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 3, 3: 53, 4: 1211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!