ID: 934685930_934685939

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 934685930 934685939
Species Human (GRCh38) Human (GRCh38)
Location 2:96321746-96321768 2:96321795-96321817
Sequence CCGAGCGCCAGCGGGAACAGCGC CCCTCCGCAGGCGCGTGCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!