ID: 934807607_934807611

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 934807607 934807611
Species Human (GRCh38) Human (GRCh38)
Location 2:97248881-97248903 2:97248927-97248949
Sequence CCTTGTTGCAATAACTCGGCCCT ATGAACAATATGCAGACTGAAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 0, 3: 2, 4: 50} {0: 3, 1: 0, 2: 3, 3: 27, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!