ID: 934836060_934836069

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 934836060 934836069
Species Human (GRCh38) Human (GRCh38)
Location 2:97590405-97590427 2:97590440-97590462
Sequence CCATGCCCGGCGCTCCTGCCGCA TGCCGCGGCCAGGCTGGCCCCGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 4, 3: 42, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!