ID: 934838110_934838116

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 934838110 934838116
Species Human (GRCh38) Human (GRCh38)
Location 2:97607859-97607881 2:97607890-97607912
Sequence CCTGGCAGAAAGTGGGGGAAGAG CCATGAGGGTTCCTGAAGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!