|
Left Crispr |
Right Crispr |
| Crispr ID |
935007307 |
935007311 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:99091562-99091584
|
2:99091578-99091600
|
| Sequence |
CCTAACACATAAGAATCCACATA |
CCACATAAACTTAAGGTAAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 58, 3: 486, 4: 801} |
{0: 5, 1: 338, 2: 468, 3: 356, 4: 546} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|