ID: 935183933_935183936

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 935183933 935183936
Species Human (GRCh38) Human (GRCh38)
Location 2:100714874-100714896 2:100714908-100714930
Sequence CCATCTTCTGAAAATAACTACTC GACAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 162, 1: 189, 2: 129, 3: 114, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!