ID: 935640061_935640070

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 935640061 935640070
Species Human (GRCh38) Human (GRCh38)
Location 2:105281827-105281849 2:105281859-105281881
Sequence CCCTGGGGAACATGTGGCAATGC ATTTTATCATGACTGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 62, 4: 355} {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!