ID: 935640062_935640068

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 935640062 935640068
Species Human (GRCh38) Human (GRCh38)
Location 2:105281828-105281850 2:105281857-105281879
Sequence CCTGGGGAACATGTGGCAATGCC CAATTTTATCATGACTGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 19, 3: 142, 4: 756} {0: 1, 1: 0, 2: 0, 3: 12, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!