ID: 935773905_935773909

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 935773905 935773909
Species Human (GRCh38) Human (GRCh38)
Location 2:106453661-106453683 2:106453683-106453705
Sequence CCATCCACTTGCCACTGACACAG GGTCTTCAAAATCTGCATTTTGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 2, 3: 29, 4: 238} {0: 7, 1: 1, 2: 6, 3: 95, 4: 1098}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!