ID: 935806540_935806543

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 935806540 935806543
Species Human (GRCh38) Human (GRCh38)
Location 2:106754259-106754281 2:106754279-106754301
Sequence CCTCCTCATAGACACAGATGGGA GGATATATATGAATATACCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!