ID: 935908039_935908042

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 935908039 935908042
Species Human (GRCh38) Human (GRCh38)
Location 2:107861631-107861653 2:107861661-107861683
Sequence CCCTTTCTCCTGAAGAACAAGAA AAAATTATCTGAGAAAGACCAGG
Strand - +
Off-target summary {0: 6, 1: 2, 2: 3, 3: 50, 4: 539} {0: 5, 1: 0, 2: 3, 3: 42, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!