|
Left Crispr |
Right Crispr |
| Crispr ID |
935994447 |
935994451 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:108753862-108753884
|
2:108753893-108753915
|
| Sequence |
CCCTTTCTCCTGAAGAACAAGAA |
AAATTATCTGAGAAAGACCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 2, 2: 3, 3: 50, 4: 539} |
{0: 5, 1: 3, 2: 8, 3: 23, 4: 341} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|