|
Left Crispr |
Right Crispr |
| Crispr ID |
936216511 |
936216514 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:110561192-110561214
|
2:110561217-110561239
|
| Sequence |
CCACCTATTCAGGAGGCAGAGAC |
GAGAATCACTTGAACCCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 9, 2: 564, 3: 12266, 4: 116813} |
{0: 21628, 1: 64917, 2: 122797, 3: 157734, 4: 166761} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|