ID: 936289654_936289663

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 936289654 936289663
Species Human (GRCh38) Human (GRCh38)
Location 2:111211731-111211753 2:111211774-111211796
Sequence CCTTGTGGGAGACAATTGAATCA GCTGTTCTCCTGACAGTGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 37, 2: 265, 3: 407, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!