ID: 936367923_936367927

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 936367923 936367927
Species Human (GRCh38) Human (GRCh38)
Location 2:111877463-111877485 2:111877478-111877500
Sequence CCCATCAGCCAGTTTTAATAATT TAATAATTATCAAGCTTGGCTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 10, 3: 75, 4: 448} {0: 1, 1: 0, 2: 1, 3: 12, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!