ID: 936424000_936424004

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 936424000 936424004
Species Human (GRCh38) Human (GRCh38)
Location 2:112399279-112399301 2:112399310-112399332
Sequence CCCTGGTCTTTGTCAGATAATTT TTCTTGTTCTTCAGGAGAAAGGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 1, 3: 29, 4: 281} {0: 6, 1: 2, 2: 3, 3: 50, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!