ID: 936551308_936551315

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 936551308 936551315
Species Human (GRCh38) Human (GRCh38)
Location 2:113443222-113443244 2:113443272-113443294
Sequence CCTCCCTGTAAGTTTAATTTTTA ACCTTCCTCAAGATGAACTAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 5, 3: 37, 4: 531} {0: 2, 1: 2, 2: 2, 3: 7, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!