ID: 936938289_936938302

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 936938289 936938302
Species Human (GRCh38) Human (GRCh38)
Location 2:117859007-117859029 2:117859036-117859058
Sequence CCCCGCCCACTGCAGGTGCAGCT CCGACGCCGCTGGGTGGGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!