ID: 937057625_937057636

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 937057625 937057636
Species Human (GRCh38) Human (GRCh38)
Location 2:118952739-118952761 2:118952785-118952807
Sequence CCCCTGAGGCCACCGCAAGAGGT AGGACTAGAGATGCCCCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!