ID: 937294208_937294217

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 937294208 937294217
Species Human (GRCh38) Human (GRCh38)
Location 2:120799916-120799938 2:120799965-120799987
Sequence CCCCTCAGGGGCGGGGATGCTCT TGGTGCTGGGCCTGGCATGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!