ID: 937427400_937427412

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 937427400 937427412
Species Human (GRCh38) Human (GRCh38)
Location 2:121811831-121811853 2:121811871-121811893
Sequence CCCAAGCCTTGGAGGCATCTTTG CCCTTTGTGGGTCTGGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 55, 4: 460} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!