ID: 937620599_937620611

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 937620599 937620611
Species Human (GRCh38) Human (GRCh38)
Location 2:123980670-123980692 2:123980684-123980706
Sequence CCAGCCCGTGAAAGCAGCCAGGG CAGCCAGGGTTGGGGGGTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 22, 3: 155, 4: 1285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!