ID: 938159455_938159460

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 938159455 938159460
Species Human (GRCh38) Human (GRCh38)
Location 2:128972675-128972697 2:128972689-128972711
Sequence CCTGGCCTTGAGTGGACAGGCTA GACAGGCTAAAGGTGGGAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 23, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!