ID: 938292565_938292577

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 938292565 938292577
Species Human (GRCh38) Human (GRCh38)
Location 2:130157829-130157851 2:130157882-130157904
Sequence CCTCCCAAGTGTGTGCAGAAAGC TGTAATTCCAGCACTTTGGGAGG
Strand - +
Off-target summary No data {0: 11596, 1: 306145, 2: 263594, 3: 149163, 4: 135954}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!