ID: 938350017_938350030

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 938350017 938350030
Species Human (GRCh38) Human (GRCh38)
Location 2:130592889-130592911 2:130592917-130592939
Sequence CCCAAGTCCCGGCCTTCCGCAGG CGCTCCCGCTGGAGGACGGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 108} {0: 2, 1: 0, 2: 0, 3: 5, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!