ID: 938350024_938350030

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 938350024 938350030
Species Human (GRCh38) Human (GRCh38)
Location 2:130592901-130592923 2:130592917-130592939
Sequence CCTTCCGCAGGGGCGCCGCTCCC CGCTCCCGCTGGAGGACGGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 25, 4: 148} {0: 2, 1: 0, 2: 0, 3: 5, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!