ID: 938469376_938469382

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 938469376 938469382
Species Human (GRCh38) Human (GRCh38)
Location 2:131544824-131544846 2:131544844-131544866
Sequence CCCTGGTGGGCCCAGCAATTTCT TCTGGCCAGTTGCACCTGGATGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 10, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!