ID: 938505785_938505792

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 938505785 938505792
Species Human (GRCh38) Human (GRCh38)
Location 2:131881178-131881200 2:131881221-131881243
Sequence CCATAGGACCAACTATAAAGTAC CCATCCAGTCAGACTGAGGCTGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 3, 3: 18, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!