ID: 938533632_938533636

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 938533632 938533636
Species Human (GRCh38) Human (GRCh38)
Location 2:132220387-132220409 2:132220402-132220424
Sequence CCTTCCACGGTCTCCCTCTGATG CTCTGATGCCGAGCCAAAGCTGG
Strand - +
Off-target summary {0: 87, 1: 19, 2: 6, 3: 18, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!