ID: 938928630_938928638 |
View in Genome Browser |
Spacer: 5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 938928630 | 938928638 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 2:136066726-136066748 | 2:136066754-136066776 |
Sequence | CCCAAGCACTGAGTCCATTCTCA | CACAGATGGAGGATGGAGGAGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 10, 3: 110, 4: 743} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |