ID: 940446537_940446542

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 940446537 940446542
Species Human (GRCh38) Human (GRCh38)
Location 2:153784639-153784661 2:153784680-153784702
Sequence CCCAGCAAAAGAGGCTGCAACTC AACTCACATACATACCCCTAGGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 24, 3: 76, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!