ID: 940856296_940856307

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 940856296 940856307
Species Human (GRCh38) Human (GRCh38)
Location 2:158730904-158730926 2:158730950-158730972
Sequence CCCTGGCCTCTCACTCCTCACCC GCCAGGTGGAAAACAAGTCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!