ID: 942034718_942034730

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 942034718 942034730
Species Human (GRCh38) Human (GRCh38)
Location 2:171999806-171999828 2:171999848-171999870
Sequence CCCTAGCCGCTTCCCAGCCAGGG GCGCGCACGCGCGCTCCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 173} {0: 1, 1: 0, 2: 0, 3: 14, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!