ID: 942034721_942034731

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 942034721 942034731
Species Human (GRCh38) Human (GRCh38)
Location 2:171999812-171999834 2:171999849-171999871
Sequence CCGCTTCCCAGCCAGGGCTCCCG CGCGCACGCGCGCTCCCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 548} {0: 1, 1: 0, 2: 1, 3: 12, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!