ID: 942034725_942034737

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 942034725 942034737
Species Human (GRCh38) Human (GRCh38)
Location 2:171999831-171999853 2:171999868-171999890
Sequence CCCGCAGTCAGCCCCGCGCGCGC CGGGCGGCCTCGACGCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 133} {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!