ID: 942045858_942045873

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 942045858 942045873
Species Human (GRCh38) Human (GRCh38)
Location 2:172099116-172099138 2:172099156-172099178
Sequence CCATCTAGGCGGGCGCGGGGGCG GGGGCAGGGCAGGCGGAGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!