ID: 942046989_942046998

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 942046989 942046998
Species Human (GRCh38) Human (GRCh38)
Location 2:172105414-172105436 2:172105440-172105462
Sequence CCACTTTATCTGTAAAACAAAGG GTGTACATGGGGGAAAGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 321} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!