ID: 942317621_942317630

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 942317621 942317630
Species Human (GRCh38) Human (GRCh38)
Location 2:174709871-174709893 2:174709897-174709919
Sequence CCGTCAAGCCCACGCCCGCCCAG TCCAGCTGGCCCGCAAGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 80, 3: 560, 4: 688} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!