ID: 944881680_944881684

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 944881680 944881684
Species Human (GRCh38) Human (GRCh38)
Location 2:204019086-204019108 2:204019118-204019140
Sequence CCTAAGTGAAATCGTAGGAAGTG ACATTCCTAGACCAGGAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!