ID: 945173482_945173489

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 945173482 945173489
Species Human (GRCh38) Human (GRCh38)
Location 2:207019584-207019606 2:207019616-207019638
Sequence CCATGTCCCATCTGTGTGGGACC ATCAGACTGTTCAACTCACCTGG
Strand - +
Off-target summary {0: 82, 1: 298, 2: 258, 3: 133, 4: 248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!