|
Left Crispr |
Right Crispr |
| Crispr ID |
945642175 |
945642179 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:212443808-212443830
|
2:212443846-212443868
|
| Sequence |
CCTGCCATGTTCTGCAGATAAGT |
GACAGCTCTTGGACTATTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 210, 3: 191, 4: 244} |
{0: 1, 1: 21, 2: 200, 3: 193, 4: 195} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|