|
Left Crispr |
Right Crispr |
| Crispr ID |
945749282 |
945749284 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:213760750-213760772
|
2:213760779-213760801
|
| Sequence |
CCACACACTGGATAATTTATATA |
TTTTTTCCTCACAGTTTTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 125, 3: 2000, 4: 14089} |
{0: 2, 1: 24, 2: 412, 3: 3167, 4: 7654} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|