ID: 946085929_946085941

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 946085929 946085941
Species Human (GRCh38) Human (GRCh38)
Location 2:217171466-217171488 2:217171516-217171538
Sequence CCACTCCTCCTTCCAACCAGATG GTTCCTGGATCAAGCTTTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!