ID: 946185513_946185527

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 946185513 946185527
Species Human (GRCh38) Human (GRCh38)
Location 2:217978598-217978620 2:217978644-217978666
Sequence CCTTGACCTGCGCCCGCTCCCAG AGAGAGGAGGAGGGACGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 238} {0: 1, 1: 0, 2: 4, 3: 49, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!