ID: 946362837_946362848

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 946362837 946362848
Species Human (GRCh38) Human (GRCh38)
Location 2:219229411-219229433 2:219229442-219229464
Sequence CCCGCCCCGCCGGCGGCGCCCCT TACCCGCCGCGAGCTCACTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 601} {0: 1, 1: 0, 2: 0, 3: 1, 4: 14}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!