ID: 946702102_946702121

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 946702102 946702121
Species Human (GRCh38) Human (GRCh38)
Location 2:222424481-222424503 2:222424507-222424529
Sequence CCCCGCCCGCCCGGCCTCCGCCC GTGCGGGATCGGCGGGGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 238, 4: 1424} {0: 1, 1: 0, 2: 1, 3: 34, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!