ID: 946702104_946702126

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 946702104 946702126
Species Human (GRCh38) Human (GRCh38)
Location 2:222424483-222424505 2:222424528-222424550
Sequence CCGCCCGCCCGGCCTCCGCCCGG GGCGGGAGTGGCGGTGCCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 111, 4: 1485} {0: 1, 1: 0, 2: 4, 3: 46, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!